Cyp2b10 gene card

Author: zvxj

August undefined, 2024

WebOct 19, 2000 · Here we show that the nuclear receptor CAR mediates the response evoked by a class of xenobiotics known as the ‘phenobarbital-like inducers’. The strong activation of Cyp2b10 gene expression ... WebMar 21, 2024 · UGT2B10 (UDP Glucuronosyltransferase Family 2 Member B10) is a Protein Coding gene. Diseases associated with UGT2B10 include Crigler-Najjar Syndrome, …

Bridging Sex-Specific Differences in the CAR-Mediated ...

WebUse Bio-Rad's PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed. Cyp2b10 - … dick\u0027s sporting goods in fort collins

Phenobarbital Mediates an Epigenetic Switch at the Constitutive

WebMar 5, 1999 · A PB-responsive enhancer activity was first associated with a 177-bp DNA sequence (−2318/−2155 bp) of the rat CYP2B2 gene in primary hepatocytes (3) and was … WebCyp2b10 Name cytochrome P450, family 2, subfamily b, polypeptide 10 Synonyms Cyp2b, Cyp2b20, p16, phenobarbitol inducible, type b Feature Type protein coding gene IDs … WebThe gene encoding cytochrome P450 2B10 (Cyp2b10) was one of the top upregulated genes in the E8G1 group and was further upregulated in the E8G3 group, but only … dick\u0027s sporting goods in huber heights ohio

Frontiers Period 2 Regulates CYP2B10 Expression and

UniProt

WebNov 25, 2016 · Because the previous results indicate that ethanol-induced Cyp2b10 expression was not mediated by CAR activation, functional mapping of the 5′ upstream region of the Cyp2b10 gene was performed to identify important regulators that may influence ethanol-induced Cyp2b10 expression. Reporter gene assays revealed that the … WebEthanol-induced Hepatic Cyp2b10 Expression Is Regulated by PPAR / -dependent Modulation of SP1 Activity—Because the previous results indicate that ethanol-induced Cyp2b10 expression was not mediated by CAR activation, functional mapping of the 5 upstream region of the Cyp2b10 gene was performed to identify important regulators … dick\u0027s sporting goods in houstonWebOct 19, 2000 · Probes for Cyp2b10 were prepared by polymerase chain reaction after reverse transcription of RNA (RT-PCR) with mouse liver total RNA using Superscript … dick\u0027s sporting goods in holly springs

"WebRNA Gene: 19: GC11P057712: 0.49: 12: AHR: Aryl Hydrocarbon Receptor: Protein Coding: P35869: 54: GC07P016916: 0.44: 13: ABCC3: ATP Binding Cassette Subfamily C … " - Cyp2b10 gene card

Cyp2b10 gene card

RegulationofCytochromeP4502B10(CYP2B10)Expression ...

WebAug 1, 2024 · Cytochrome P450s (P450s) are a large family of heme-containing monooxygenase enzymes that oxidatively metabolize xenobiotics such as drugs and environmental pollutants ( Gonzalez, 1988; Isin and Guengerich, 2007 ). WebMar 5, 2024 · Cyp2b10 cytochrome P450, family 2, subfamily b, polypeptide 10 [ (house mouse)] Gene ID: 13088, updated on 5-Mar-2024 Summary Predicted to enable heat …

Did you know?

WebNov 23, 2024 · Expression of CYP2B10 is known to be regulated by a number of nuclear receptors such as pregnane X receptor (PXR), constitutive androstane receptor (CAR), glucocorticoid receptors (GR), and vitamin D receptor (VDR) ( Beigneux et al., 2002; Pascussi et al., 2004 ). Period 2 (PER2) is a central component of the mammalian … WebA distal gene fragment, at about -2000 kb in CYP2B1, CYP2B2, and Cyp2b10, has been shown to be a phenobarbital-responsive enhancer independent of proximal promoter …

WebMar 21, 2024 · CYP2B6 (Cytochrome P450 Family 2 Subfamily B Member 6) is a Protein Coding gene. Diseases associated with CYP2B6 include Efavirenz, Poor Metabolism Of … WebMar 27, 2024 · GeneCards is a searchable, integrative database that provides comprehensive, user-friendly information on all annotated and predicted human genes. The knowledgebase automatically integrates gene-centric data from ~150 web sources, including genomic, transcriptomic, proteomic, genetic, clinical and functional information. …

WebMar 28, 2024 · The Cyp2b10 guide sequence was: uguggaggagcggauucagg (AGG). The Cyp2b13 guide sequence was: (CCC)ugcaagagguuccccaagag, and the Cyp2b9 guide sequence was: acattgatacctaccttctg (AGG). The protospacer adjacent motif (PAM) is shown in parenthesis. The incorporation efficiency at each site in vitro was Cyp2b10, 47.6%, … WebFind many great new & used options and get the best deals for 1990 Classic WWF #51 Mean Gene Okerlund Wrestling Card Pristine Mint New at the best online prices at eBay! Free shipping for many products!

WebNov 25, 2016 · Chronic ethanol treatment causes increased hepatic CYP2B10 expression inPparβ/δ +/+ mice but not in Pparβ/δ-/-mice. Nuclear and cytosolic localization of the …

WebThe constitutive androstane receptor ( CAR) also known as nuclear receptor subfamily 1, group I, member 3 is a protein that in humans is encoded by the NR1I3 gene. [5] CAR is a member of the nuclear … dick\u0027s sporting goods in huntington beachWebCyp2b10cytochrome P450, family 2, subfamily b, polypeptide 10 [ Mus musculus(house mouse) ] Gene ID: 13088, updated on 26-Sep-2024 Download Datasets Gene Sequences (FASTA) Transcript sequences (FASTA) Protein sequences(FASTA) city bus lanzaroteWebJun 1, 2024 · The expression of Cyp2b10, Cyp3a11, Gadd45b and Cyp1a1 genes was analyzed in DAS treated and vehicle treated mice livers. The same RNA samples treated … city bus leicesterWebNov 23, 2024 · CYP2B10 is responsible for metabolism and detoxification of many clinical drugs. Here, we aimed to investigate a potential role of Period 2 (PER2) in regulating … city bus kelownaWebMar 7, 2024 · CYP2B10 Antibody (b/e3) is a mouse monoclonal IgG 1 κ, cited in 10 publications, provided at 200 µg/ml. raised against liver cytochrome P4502B1 and 2B2 of … city bus lengthWebCyp2b10cytochrome P450, family 2, subfamily b, polypeptide 10 [ Mus musculus(house mouse) ] Gene ID: 13088, updated on 26-Sep-2024 Download Datasets Gene … citybus leinfeldenWebFeb 17, 2003 · The CYP2B10 mRNA is expressed in the lungs of both wild-type and CAR-null mice, and is not induced by PB treatment (Fig. 3). Thus, CAR does not regulate the constitutive expression of the Cyp2b10 gene in mouse lung. Whether CAR regulates the Cyp2b10 expression in mouse intestine remains to be investigated. Download : … citybus limited address